Информация

Дизайн грунтовки для PRP24-TAPtag

Дизайн грунтовки для PRP24-TAPtag



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

У меня проблема с домашним заданием по протеомике. Меня попросили разработать праймеры, используемые для создания бокса гомологичной рекомбинации для создания дрожжей PRP24-TAPtag. Я знаю, что гомологичные области должны иметь размер 40-50 нт и что мой праймер должен включать выступы. Мне сказали основываться на этой публикации: https://www.ncbi.nlm.nih.gov/pubmed/11403571

Раньше я разрабатывал праймеры, но на этот раз столкнулся с действительно большими проблемами. Я нашел обе последовательности белков моей плазмиды, pBS1479, TAPtag и PRP24, но я понятия не имею, как мне присоединиться к ним для создания праймеров и как включить TAPtag. Я впервые использую этот метод. Могу ли я использовать какие-нибудь инструменты для этой задачи? Должен ли я добавить последовательность тегов к C-концу моего белка, а затем использовать последовательность плазмид для создания выступов?


Инструменты для дизайна Oligo

Хороший дизайн праймера важен для успешной реакции ПЦР. При разработке оптимальных праймеров для интересующего вас гена необходимо учитывать множество факторов. Вот несколько советов, которые следует учитывать при разработке праймеров.

Советы по дизайну грунтовки

  • Как правило, длина праймеров составляет 18–30 нуклеотидов.
  • Попробуйте сделать температуру плавления (Tм) грунтовок при температуре от 65 ° C до 75 ° C и в пределах 5 ° C друг от друга.
  • Если Tм вашего праймера очень мало, попробуйте найти последовательность с большим содержанием GC или немного увеличьте длину праймера.
  • Стремитесь к тому, чтобы содержание GC составляло от 40 до 60%, при этом 3 'праймера оканчиваются на C или G, чтобы способствовать связыванию.
  • Обычно от 3 до 4 нуклеотидов добавляют к 5 ’сайту рестрикционного фермента в праймере, чтобы обеспечить эффективное разрезание.
  • Старайтесь избегать областей вторичной структуры и иметь сбалансированное распределение GC-богатых и AT-богатых доменов.
  • Старайтесь избегать повторений 4 или более одного основания или динуклеотидных повторов (например, ACCCC или ATATATAT).
  • Избегайте гомологии внутри праймера (более 3 оснований, которые дополняют праймер) или гомологии между праймерами (прямые и обратные праймеры, имеющие комплементарные последовательности). Эти обстоятельства могут привести к самодимерам или димерам праймеров вместо отжига с желаемыми последовательностями ДНК.
  • Если вы используете праймеры для клонирования, мы рекомендуем очистку картриджа в качестве минимального уровня очистки.
  • Если вы используете праймеры для мутагенеза, постарайтесь расположить несоответствующие основания ближе к середине праймера.
  • Если вы используете праймеры для реакции ПЦР для клонирования Invitrogen TOPO, праймеры не должны иметь фосфатных модификаций.

ОлигоИдеальный дизайнер

Invitrogen OligoИдеальный дизайнер это бесплатный, простой и эффективный облачный инструмент для создания праймеров на основе Primer 3, который работает с загружаемыми вами до 50 последовательностями шаблонов ДНК. Как и программа Vector NTI Advance, OligoPerfect Designer легко подключается к нашей системе онлайн-заказов, поэтому вам никогда не придется вырезать и вставлять последовательности.

Инструмент Primer Designer Tool

В Инструмент Primer Designer Tool позволяет быстро искать, настраивать и заказывать праймеры для этапа подтверждения Сэнгера рабочего процесса NGS. База данных состоит из

650 000 предварительно разработанных пар праймеров для повторного секвенирования экзома человека и митохондриального генома человека.


Резюме автора

Полимеразная цепная реакция - широко применяемый метод, помогающий идентифицировать бактериальные и вирусные патогены, зародышевые и соматические мутации. А праймеры - одна из самых важных частей каждого ПЦР-анализа, определяющая его чувствительность и специфичность. Многие инструменты были разработаны для автоматического конструирования праймеров, однако ни один из них не позволяет разрабатывать мультиплексные ПЦР-анализы, требующие конструирования от двух до тысяч праймеров с помощью одной-двух команд. Здесь мы представляем такой инструмент под названием NGS-PrimerPlex, который изначально был разработан для создания новых целевых NGS-панелей. Этот подход получил широкое распространение, поскольку он позволяет нацеливаться только на интересующие области генома, снижая стоимость анализа. Мы показали, что NGS-PrimerPlex может применяться для обнаружения множественных патогенов и секвенирования экзонов LRRK2 ген у пациентов с болезнью Паркинсона. Разработанные праймеры были проверены на 354 образцах ДНК, для которых LRRK2 кодирующие последовательности успешно исследованы на платформе MiniSeq Illumina.

Цитата: Кечин А., Боробова В., Боярских Ю., Храпов Е., Субботин С., Филипенко М. (2020) NGS-PrimerPlex: Дизайн высокопроизводительных праймеров для мультиплексных полимеразных цепных реакций. PLoS Comput Biol 16 (12): e1008468. https://doi.org/10.1371/journal.pcbi.1008468

Редактор: Михаэла Пертеа, Университет Джона Хопкинса, США

Полученный: 2 июля 2020 г. Принято: 24 октября 2020 г. Опубликовано: 30 декабря 2020 г.

Авторское право: © 2020 Кечин и др. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Доступность данных: Данные были загружены в базу данных NCBI Sequence Read Archive. Данные доступны в Биопроекте по адресу https://www.ncbi.nlm.nih.gov/bioproject/PRJNA664536.

Финансирование: Работа поддержана в рамках проекта ИБФМ СО РАН, финансируемого из государственного бюджета РФ № АААА-А17-117020210025-5 «Разработка методов персонализированной медицины» для АК, ВБ, УБ, ЭК, СС, МФ. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили, что не существует никаких конкурирующих интересов.

Это Вычислительная биология PLOS Программная бумага.


IMC предлагает различные методы создания праймеров для ПЦР.

Возможность просто перетащить нуклеотидную последовательность на дорожку последовательности и зарегистрировать ее в качестве праймера.

Возможность конструирования элементов на полосе элементов и праймеров для усиления внутри и за пределами выбранной области

  • Дизайн праймера для усиления включенных продуктов, включая избранные особенности функциональных полос
  • Дизайн праймера для амплификации продукта, содержащего или содержащего выбранную геномную область характерной полосы

Функция конструирования праймеров, которые усиливают большое количество областей одновременно (с функцией Iterate Design: это функция, позволяющая повторять дизайн до тех пор, пока не останется области, которая не может быть спроектирована)

  • Дизайн праймера для пакетной ПЦР Дизайн праймера для пакетной ПЦР для усиления всех характеристик с указанным ключом функции в геноме
  • Дизайн ПЦР-праймера, покрывающий весь геном Дизайн ПЦР-праймера, при котором продукт ПЦР полностью перекрывает весь геном или большую геномную область с перекрытием продукта ПЦР
  • Дизайн праймера для секвенирования: Дизайн праймера для секвенирования фрагментов ДНК, которые нельзя покрыть одним проводом капиллярного секвенатора.
    ссылка

Ниже приводится функция для создания группы праймеров для одновременного клонирования нескольких фрагментов ДНК, например для создания кластера генов. От дизайна до клонирования вы можете загружать клонированные продукты в IMC.


Дизайн праймеров для ПЦР

Дизайн праймеров для ПЦР
Общие соображения по проектированию. Убедись в том, что:

  • Длина праймера составляет 15-30 п.н., гомологичных последовательности ДНК-мишени. Я предлагаю начать с праймеров 20-25 п.н.
  • Tm каждого праймера составляет 55-65 ° C.
  • Содержание GC в каждом праймере составляет 40-60%.
  • Tm обоих праймеров очень похожи, т.е. в пределах

Особые соображения по поводу запчастей Golden Gate

Особые рекомендации по деталям BioBrick

    • Убедитесь, что геномная ДНК, подлежащая амплификации, не содержит сайтов EcoRI, PstI, SpeI или XbaI.
    • Обычно я создаю продукт PCR, у которого есть сайт XbaI перед частью, а сайты SpeI, NotI и PstI ниже по течению.
    • Часть Biobrick начинается со стартового кодона (ATG) и заканчивается двумя последовательными стоп-кодонами (TAATAA).
    • Тогда передний праймер должен иметь вид:

    5 & ​​# 8242 CCTTTCTAGAG (15-20 п.н. кодирующей цепи, начиная с ATG) 3 & # 8242

    а обратный праймер должен иметь вид:

    5 & ​​# 8242 AAGG & # 8217CTGCAGCGGCCGCTACTAGT & # 8217A (обратный комплемент 15-20 п.н., начиная с TTATTA) 3 & # 8242

    Здесь есть четыре нуклеотида (выделены курсивом), фланкирующие сайты рестрикции (выделены жирным шрифтом), такие спейсеры необходимы для правильного разрезания рестрикционных ферментов.

    Особые рекомендации для деталей BioFusion

    • Убедитесь, что геномная ДНК, подлежащая амплификации, не содержит сайтов EcoRI, PstI, SpeI или XbaI.
    • Обычно я создаю продукт PCR, у которого есть сайт XbaI перед частью, а сайты SpeI, NotI и PstI ниже по течению.
    • Вставка для прямого праймера не начинается с TC (иначе образуется сайт DAM I (GATC), и XbaI не может разрезать).
    • Конструкция Biofusion не начинается со стартового кодона и не заканчивается стоп-кодоном.
    • Тогда передний праймер должен иметь вид:

    5 & ​​# 8242 & # 8221CCTT & # 8221 & # 8221 & # 8217TCTAGA & # 8221 & # 8217 (15-20 п.н. кодирующей цепи) 3 & # 8242
    а обратный праймер должен иметь вид:
    5 & ​​# 8242 & # 8221AAGG & # 8221 & # 8221 & # 8217CTGCAGCGGCCGCTACTAGT & # 8221 & # 8217 (обратное дополнение 15-20 п.н.) 3 & # 8242
    Здесь есть четыре нуклеотида (выделены курсивом), фланкирующие сайты рестрикции (выделены жирным шрифтом), такие спейсеры необходимы, чтобы позволить рестрикционным ферментам правильно разрезать.

    • Примечание: если невозможно получить хороший набор праймеров с фланкирующими областями, описанными выше, попробуйте изменить первые 4 основания & # 8211, которые являются внешними по отношению к сайту рестрикции & # 8211 каждого праймера, например & ltbr & gt5 & # 8242 & # 8221AAGG & # 8221 & # 8221 & # 8217TCTAGA & # 8221 & # 8217 (15-20 п.н. кодирующей цепи) 3 & # 8242 & ltbr & gt
    • Примечание: если вы все еще не можете получить хороший набор праймеров, попробуйте использовать совершенно другой набор фланкирующих областей для улучшения праймеров. Например, вы также можете использовать продукт ПЦР, у которого есть сайты EcoRI, NotI и XbaI перед вашей частью, в то время как сайт SpeI находится ниже вашей части.

    В этом случае прямой праймер будет иметь форму: 5 & # 8242 & # 8221CCTT & # 8221 & # 8221 & # 8217GAATTCGCGGCCGCATCTAGA & # 8221 & # 8217 (комплемент 15-20 п.н. к кодирующей цепи) 3 & # 8242, а обратный праймер должен иметь вид форма: & ltbr & gt 5 & # 8242 & # 8221AAGG & # 8221 & # 8221 & # 8217ACTAGT & # 8221 & # 8217 (дополнение 15-20 п.н. к кодирующей цепи) 3 & # 8242.

    Создание праймеров с использованием Vector NTI
    Простой способ создания праймеров - использовать Vector NTI.


    Выводы

    Мы демонстрируем, что PrimalSeq может точно измерить внутрихозяйственное генетическое разнообразие вирусов при правильной проверке. Мы протестировали наш высоко мультиплексированный и оптимизированный метод секвенирования на основе ампликонов, используя серию экспериментов со смешанными популяциями вирусов, разработали комплексный инструмент вычислительного анализа (iVar) и продемонстрировали его полезность, измеряя внутрихозяинное разнообразие вирусов в клетках, комарах, приматах, птицы и люди. Кроме того, с помощью нашего бесплатного онлайн-конструктора учебников Primal Scheme (primal.zibraproject.org) [17] PrimalSeq можно модифицировать для использования с широким спектром вирусов. В целом, наши подробные лабораторные и вычислительные подходы, представленные здесь, могут дать важную информацию об эволюции вируса внутри хоста непосредственно из клинических или экспериментальных образцов дешевым, точным и масштабируемым способом.


    3.4: ПРИЛОЖЕНИЕ C1 - Дизайн праймера для сайт-направленного мутагенеза.

    • Предоставлено Элизабет Фогель Тейлор
    • Инструктор HHMI (химия) в Технологическом институте Массечусетса
    • Источник из MIT OpenCourseWare

    Праймеры также могут быть разработаны с использованием программы создания праймеров (http://www.stratagene.com/qcprimerdesign) или проверены этим методом после проектирования. Tm необходимо рассчитать по приведенной ниже формуле.

    C1: Пример пошагового дизайна праймеров для мутации Abl H396P 53

    Конструкция переднего (от 5 до 3 дюймов) грунтовки:

    • Определите код ДНК, соответствующий His396. Для этого умножьте номер остатка на 3, а затем вычтите 2, чтобы получить первый п.н. в кодоне 3 п.н. Добавьте 3 основания к этому номеру (см. Приложение B2 для объяснения причин), чтобы преобразовать его в нумерацию, соответствующую записи в Genbank NM_005157. (396 * 3) & ndash 2 + 3 = 1189 His396 кодируется парами оснований 1189-1191, которые являются CAT.
    • Убедитесь, что кодон соответствует правильной аминокислоте, используя инструмент трансляции ДНК в белок (http://www.expasy.ch/tools/dna.html). Если это предусмотрено в Приложении B3, подтвердите, что нумерация нуклеотидной замены попадает в кодон, определенный выше (здесь 1189-1191), и используйте инструмент транслятора, чтобы убедиться, что изменение bp приводит к ожидаемой аминокислотной замене. Если изменение ДНК не указано в списке, определите, какая нуклеотидная замена дает желаемую аминокислотную замену. Для H396P мутация A1190C приводит к кодону CCT (Pro), как и ожидалось.
    • Напишите желаемую мутацию (выделена жирным курсивом ниже) с 12 фланговыми основаниями с каждой стороны.
      CC TAC ACA GCC CCT GCT GGA GCC AA
    • Первый и последний остатки вашего праймера должны иметь обозначение G или C. Добавьте основания по мере необходимости на каждый конец вашего праймера, чтобы каждый конец оканчивался буквами G или C.
      CC TAC ACA GCC CCT GCT GGA GCC AAG TTC
    • Убедитесь, что ваш грунт содержит не менее 40% GC. При необходимости добавили больше оснований к одному или обоим концам для достижения более высокого% GC. % Содержания GC = ((количество оснований G / C) / (общее количество оснований)) * 100% = (18/29) X 100 = 62% GC
    • Рассчитайте% несоответствия вашего грунтовочного покрытия. % несоответствия = 1/29 * 100% = 3%
    • Рассчитайте температуру плавления (Tm) вашей грунтовки. В приведенном ниже уравнении N - длина праймера в основаниях, а% GC и% несоответствия должны быть записаны целыми числами.
      Тм = 81,5 + 0,41 (% GC) & ndash 675 / N -% несоответствия = 81,5 & ndash (0,41) (62) & ndash 675/29 -3 = 80,6 & ordmC
    • Тм грунтовки должно быть больше или равно 78 ° C. Если Tm меньше 78 ° C, увеличьте длину грунтовки или увеличьте содержание% G / C, чтобы увеличить Tм. Однако убедитесь, что длина вашего праймера не превышает 45 оснований.
      Прямой праймер: 5 & rsquo CC TAC ACA GCC CCT GCT GGA GCC AAG TTC 3 & rsquo

    Дизайн антисмыслового праймера, который является обратным дополнением прямого праймера:


    Операция

    Обозначение площади

    1. Перетащите любую область на карте объектов с помощью мыши.
    2. Перетаскиваемая область отображается красным цветом.

    Дизайн грунтовки

    1. Щелкните правой кнопкой мыши на карте объектов.
    2. Появится всплывающее меню.
    3. Выберите в меню «Дизайн праймера для ПЦР».
    4. Отобразится диалоговое окно «Дизайн праймера для ПЦР».

    При настройке, отличной от значения по умолчанию

    1. Нажмите «Показать параметры» в диалоговом окне «Дизайн праймера для ПЦР».
    2. Отображаются подробные параметры.
    3. Чтобы изменить регион для усиления, введите значение непосредственно в поля «От:» и «Кому:» и нажмите кнопку «Изменить».
    4. Целевая область усиления изменена.
    5. Чтобы изменить количество оснований, расположенных выше области амплификации, для поиска праймерного сайта, введите число непосредственно в поле «Диапазон поиска праймера (дополнительные вышестоящие основания) (п.н.)».
    6. В этом случае поиск праймера осуществляется от позиции основания From: до количества оснований, введенного в это поле.
    7. Установите то же самое для стороны выхода.
    8. Для диапазона длины основания грунтовки введите минимальную длину основания и максимальную длину основания непосредственно в поле «Макс. Диапазон размера грунтовки». Поле.
    9. Для диапазона Tm грунтовки введите минимальную температуру Tm (° C) и максимальную температуру Tm (° C) непосредственно в поле «Tm Range Min.» И «Tm Range Max.» Поля.
    10. Для диапазона содержания ГХ в грунтовке введите минимальное содержание ГХ (%) и максимальное содержание ГХ (%) непосредственно в «Мин. Диапазон ГХ». И «Макс. Диапазон ГХ». Поля.
    11. Чтобы указать концентрацию олигонуклеотидов отжига, введите концентрацию (нМ) непосредственно в поле «Концентрация олигонуклеотидов отжига».
    12. Чтобы указать концентрацию соли, введите круговую концентрацию (нМ) непосредственно в поле «Концентрация соли».
    13. Указывает порог оценки для оценки наличия самокомплементарности праймера.
    14. Если балл меньше или равен баллу поля Max SelfarComplementarity, праймер является приемлемым.
    15. При обнаружении повторяющихся последовательностей в праймерах укажите максимальную длину основания, которая не будет распознаваться как повторяющаяся последовательность, в поле «Max Sequence Repeats».
    16. То есть, если есть две или более идентичных последовательностей с длиной основания больше, чем эта длина основания, они не будут использоваться в качестве праймеров.
    17. Укажите максимальную разницу Tm между парами праймеров, напрямую введя ее в поле «Max Tm Differenece».
    18. Подготовлены три параметра, чтобы проверить, есть ли сайт прайминга в целевой области ДНК.
    19. Для проверки используется Blast1, поэтому параметры такие же, как и у Blast.
      • «Cutoff Expectation Value» указывает ожидаемое значение, которое является порогом обнаружения.
      • «Cutoff Percent Identity» указывает пороговое значение того, какой процент или более совпадений длин оснований праймеров.
      • «Длина перекрытия отсечки» указывает минимальное количество перекрытий оснований между праймером и последовательностью прайминга ДНК.
    20. Нажмите кнопку «Установить».
    21. Появится окно со списком оптимального набора праймеров для ПЦР.
    22. Сообщение об ошибке отображается, если не может быть разработан оптимальный набор праймеров.

    23. Если вы не можете спроектировать Грунтовку, измените параметры дизайна и перепроектируйте.

    Подтверждение области амплификации

    1. При нажатии на каждую строку списка набора праймеров область амплификации, соответствующая этому набору праймеров, отображается в цвете.

    Выполните ПЦР-амплификацию

    1. Установите флажок Primer Set, который будет использоваться в Primer Design. .
    2. Щелкните Amplify.
    3. Появится подтверждающее сообщение «Начать ПЦР».
    4. Появится окно Amplify List со списком продуктов амплификации.

    Загрузка продуктов амплификации

    1. Чтобы добавить продукт для амплификации в основной каталог, установите флажок для этого продукта.
    2. Щелкните Загрузить.
    3. Загрузка выполняется, и когда она завершена, отображается сообщение о завершении.
    4. Сгенерированная последовательность продукта ПЦР добавляется в текущий основной каталог.

    Просмотрите последовательности продуктов амплификации

    1. Щелкните последовательность продуктов ПЦР, добавленных в текущий основной каталог.
    2. Отображается карта характеристик продукта ПЦР.

    Дизайн грунтовки для PRP24-TAPtag - Биология

    Вырожденные праймеры полезны для извлечения одной части последовательности гена, когда вы знаете только последовательность гена в родственных организмах. Чем дальше от них расположены родственные органы, тем сложнее может быть создание праймеров.

    Одно из решений - собрать последовательности от большого количества организмов (скажем, от всех позвоночных, если вы работаете с рыбами), преобразовать их в аминокислотную последовательность и выровнять их. На основе этих выравниваний можно идентифицировать участки последовательности, которые являются высококонсервативными на аминокислотном уровне. Эти консервативные области становятся возможными местами для вырожденных праймеров.

    Вырожденные праймеры предназначены для соответствия аминокислотной последовательности. Последовательность ДНК и соответствующая ей аминокислотная последовательность будут

    п F Т K
    CCn TTy ACn AAr

    Здесь n = A, C, G или T
    у = С, Т
    г = А, G

    Для ПЦР необходимы две консервативные области для расположения прямого и обратного праймеров. Каждая из них должна быть длиной не менее 5 AA (предпочтительно 6 или 7 AA) и достаточно близко друг к другу. Если эти области расположены слишком далеко друг от друга, эффективность ПЦР упадет, и вы не получите большой амплификации. Разумная цель - 400 б.п., хотя 200-600 б.п. тоже должны работать. Чем меньше деградируют ваши грунтовки, тем дальше они могут быть друг от друга. Следующая задача - определить, какой из возможных праймеров наименее вырожден. Глядя на код аминокислот, некоторые аминокислоты кодируются большим количеством возможных триплетных кодонов, чем другие. Таблица AAcode показывает, что вырождения:

    1-кратные сайты M Вт
    2-кратные сайты F Y H Q N K D E C
    3 раза сайты я
    4-кратные сайты В П Т А Г
    6-кратные сайты L S R

    При разработке вырожденных праймеров вы хотите избежать 6-кратных сайтов (L, S и R) и максимизировать количество 1- или 2-кратных сайтов в области. Вы можете сравнить степень вырождения возможных грунтовок. Чтобы вычислить вырождение, умножьте вырождения каждого из участвующих AA. Например, если у вас есть праймер, который соответствует последовательности AA D E W V P, это будет соответствовать вырожденности 2 * 2 * 1 * 4 * 4 = 64.

    Затем вам просто нужно взвесить факторы вырождения и расстояние, разделяющее прямой и обратный праймеры, чтобы выбрать пару для испытания.

    Последний трюк - добавить хвосты к вырожденным праймерам на 5 'концах. Это помогает повысить эффективность ПЦР этих праймеров за счет увеличения длины праймера и, следовательно, температуры отжига. Хотя хвосты не помогают в первых нескольких раундах ПЦР, когда амплифицируется только геномная матрица, хвосты действительно совпадают в последующих циклах ПЦР, когда вы амплифицируете короткие продукты ПЦР, содержащие праймеры на каждом конце. Хвосты, которые я успешно использовал:

    5 'конец прямого праймера GCGCGGAATTC (EcoRI)
    5 'конец обратного праймера GCGCGCAAGCTT (HindIII)

    У них есть дополнительное преимущество, заключающееся в том, что они включают сайты рестрикции, которые можно использовать для направленного клонирования. В качестве альтернативы они заканчиваются концевыми буквами G, что побуждает Taq добавлять выступающие A для использования при клонировании TA.

    Одним из примеров вырожденных праймеров, которые я использовал, являются праймеры для амплификации фрагмента 200 п.н. всех генов опсина колбочек. Две консервативные области AA охватывают области с 6 по 7 TM. Эти последовательности AA

    Нападающий: A S T Q K A E
    Реверс: Y N P I / V I Y V

    Прямой праймер, включая тег EcoRI, становится: 5 'GCGCGGAATTCGCNTCNACNCARAARGCNGA 3'

    Этот праймер является вырожденным в 1024 раза. Самая большая часть 3'-основания может быть вырожденной, но получение вырожденных праймеров там, где первая основа (самая большая 3'-основание) является вырожденной, довольно дорого. Их необходимо производить в более высоком масштабе синтеза. Для самых дешевых дегенеративных грунтовок сделайте первую основу одной цельной.

    Обратный праймер, включающий тег HindIII, становится: 3 'TAY AAY CCN RTN ATN TAY GTAAGCTT 5'

    Этот праймер также является вырожденным в 1024 раза. Это соответствует кодирующей нити. Для праймера он должен быть на другой цепи (и, таким образом, иметь обратную комплементацию). После этого грунтовка на заказ становится

    Обратный праймер: 5 'GCGCGCAAGCTTAC RTA NAT NAY NGG RTT RTA

    Эти праймеры находятся на верхнем конце вырождения. Однако они работают при температуре отжига 40 С.

    В Центре исследования рака им. Фреда Хатчинсо существует программа для создания вырожденных праймеров под названием Codehop (COnsensus DEgenerate Hybrid Oligonucleotide Primers). KC 5/03


    Задайте следующие параметры праймера:

    • Размер продукта ПЦР / ампликона: Для эффективной амплификации конструируйте праймеры так, чтобы ампликон имел длину от 70 до 200 п.н.
    • Количество возвращаемых праймеров: Это зависит от вас, в зависимости от того, из скольких вариантов вы хотите выбрать. Программа не займет много времени, чтобы разработать 10 пар праймеров, и это должно дать вам разумные шансы найти подходящую пару.
    • Температура плавления: Как правило, стремитесь к минимуму 60 ° C и максимуму 63 ° C. Идеальная температура плавления составляет 60 ° C (с максимальной разницей в 3 ° C в температурах плавления, Tm, двух грунтовок). Вы можете использовать калькулятор Tm для определения этих температур.

    Разработка праймеров для ПЦР для клонирования - (12 апреля 2013 г.)

    Привет,
    Срочно нужна помощь по вопросу для задания, которое поставило меня в тупик в течение 2 дней.

    Я предполагал клонировать и экспрессировать ген, кодирующий белок / фермент, известный как CobT, продуцируемый бактерией Mycobacterium avium paratuberculosis. Теперь мне нужно разработать праймер, который поможет мне амплифицировать, клонировать и экспрессировать белок. Проблема в том, что я совершенно не понимаю, как это сделать.

    Как создать грунтовку? Я знаю, что это очень простой вопрос, но множество руководств, которые я видел, сбили меня с толку.
    Я пробовал использовать инструмент ncbi primer blast tool, но казалось, что все праймеры, которые он мне дал, были внутри моей целевой последовательности, что не имеет смысла, как использовать инструмент ncbi для выбора праймеров?

    Есть ли разница между праймером для клонирования и праймером для ПЦР?

    Любая помощь будет оценена по достоинству.

    Нуклеотидная последовательность CobT прилагается ниже, целевая последовательность выделена синим цветом.

    Хорошо, так как вам нужна полная кодирующая последовательность гена - у вас нет выбора, где разместить праймеры, поэтому праймер BLAST не работал на вас. Вам необходимо использовать первые 20-25 п.н. гена и обратный комплемент последних 20-25 п.н. гена, включая стартовый и стоп-кодоны соответственно. Попробуйте согласовать содержание и длину ГХ, чтобы получить аналогичные температуры отжига для праймеров, но это несущественно.

    Если вам нужно добавить сайты рестрикции или что-нибудь еще к праймерам, они всегда находятся на конце 5 'праймера. Если вы делаете это, вам также необходимо добавить несколько (обычно 6) п.н. на конец 5'39 перед сайтом ограничения, чтобы RE было где-то связываться.

    По сути, нет никакой разницы между праймерами для клонирования и праймерами для обычной ПЦР, за исключением того, что к праймерам для клонирования часто добавляются хвосты, которые содержат сайты рестрикции или теги (для белка, например, метку-флаг). Это не обязательно, если вы выполняете клонирование TA или клонирование с тупым концом.

    bob1 в Сб Апр 13 00:08:45 2013 сказал:

    Хорошо, если вам нужна полная кодирующая последовательность гена - у вас нет выбора, куда вы помещаете праймеры, поэтому праймер BLAST не работал на вас. Вам необходимо использовать первые 20-25 пар оснований гена и обратный комплемент последних 20-25 пар оснований гена, включая стартовый и стоп-кодоны соответственно. Попробуйте согласовать содержание ГХ и длину, чтобы получить аналогичные температуры отжига для праймеров, но это не обязательно.

    Если вам нужно добавить сайты рестрикции или что-нибудь еще к праймерам, они всегда находятся на конце 5 'праймера. Если вы делаете это, вам также необходимо добавить несколько (обычно 6) п.н. на конец 5'39 перед сайтом ограничения, чтобы RE было где-то связываться.

    По сути, нет никакой разницы между праймерами для клонирования и праймерами для обычной ПЦР, за исключением того, что к праймерам для клонирования часто добавляются хвосты, которые содержат сайты рестрикции или теги (для белка, например, метку-флаг). Это не обязательно, если вы выполняете клонирование TA или клонирование с тупым концом.

    Спасибо за отличный ответ. У меня есть еще несколько вопросов, поэтому я уверен, что понял то, что вы написали. Поправьте меня, если я ошибаюсь.

    Скажем, это последовательность ДНК, и я хотел усилить область, подчеркнутую и выделенную жирным шрифтом:
    GAT CAT AAA ACA TGC TTG TAT AAA GGA TGC TGC CAT GTT CCG TGA ACT GGA AGC GAA CAA TCT TGC GGT
    ATA TCA GAA AAA GCC AAA GCT GAT TGC AGT GCT TCT TCA GCG TAA TGC TCA
    GTT AAA AGC GAA GGT TGT

    1. Мой пример для начинающих: 5 & ​​# 39 (GCATGC GGATCC ATG) TTG TAT AAA GGA TGC TGC CAT GTT 3 & # 39
    где синие основания - это дополнительные основания, позволяющие рестрикционному ферменту связываться, красный - это сайт рестрикции, а оранжевый - стартовый кодон.

    2. Обратный праймер: 5 & ​​# 39 (CTAAGT CCATGG CTA) TGA GCA TAA CGC TGA AGA AGC ACT 3 & # 39
    где желтый - дополнительные основания, зеленый - сайт рестрикции, а фиолетовые основания - стоп-кодон.


    -Когда тогда вы бы использовали праймер или какой-либо из этих инструментов для создания праймеров?

    -Во время учебного курса нам дали большую последовательность и сказали выбрать праймеры для амплификации заданной области в последовательности. Теперь нам сказали, что мы можем выбирать праймеры из любой точки большой последовательности, если она фланкирует интересующую нас область. Это еще один способ подобрать грунтовку? Не приведет к тому, что вы амплифицируете больше оснований, чем требуется, так что, когда вы клонируете продукт ПЦР в вектор и пытаетесь его экспрессировать, вы можете получить другой белковый продукт, смешанный с целевым белком, или, возможно, даже другой белковый продукт. ?
    Я также видел учебник, в котором праймеры являются основаниями непосредственно перед интересующей областью, то есть синий - это последовательность интеретов, красный - праймер.
    3 & # 39 GAT CAT AAA ACA TGC (TTG TAT AAA GGA TGC TGC CAT GTT CCG TGA ACT GGA AGC GAA CAA TCT) 5 & # 39
    5 & ​​# 39 CTA GTA TTT TGT ACG

    -Есть ли причина наносить грунтовки в разных местах, даже если это кажется контрпродуктивным?

    Праймеры мне нравятся. Некоторые люди рекомендуют ставить 3-6 п.н. между сайтом рестрикции и старт-стоп-кодоном, но в этом нет необходимости.

    taiju в сб, 13 апр, 01:58:12 2013 сказал:

    -Когда тогда вы бы использовали праймер или какой-либо из этих инструментов для создания праймеров?

    -Во время учебного курса нам дали большую последовательность и сказали выбрать праймеры для амплификации заданной области в последовательности. Теперь нам сказали, что мы можем выбирать праймеры из любой точки большой последовательности, если она фланкирует интересующую нас область. Это еще один способ подобрать грунтовку? Не приведет к тому, что вы амплифицируете больше оснований, чем требуется, так что, когда вы клонируете продукт ПЦР в вектор и пытаетесь его экспрессировать, вы можете получить другой белковый продукт, смешанный с целевым белком, или, возможно, даже другой белковый продукт. ?
    Я также видел учебник, в котором праймеры являются основаниями непосредственно перед интересующей областью, то есть синий - это последовательность интеретов, красный - праймер.
    3 & # 39 GAT CAT AAA ACA TGC (TTG TAT AAA GGA TGC TGC CAT GTT CCG TGA ACT GGA AGC GAA CAA TCT) 5 & # 39
    5 & ​​# 39 CTA GTA TTT TGT ACG

    -Есть ли причина наносить грунтовки в разных местах, даже если это кажется контрпродуктивным?

    небольшие комментарии по поводу предлагаемых вами грунтовок:

    третий триплет из добавленных оснований обратного праймера: вы написали «таа», я думаю, вы имели в виду «тта»

    Если вы заканчиваете оба праймера буквой «t», рекомендуется заканчивать буквой «g» или «c», чтобы закрепить праймер.

    mdfenko on Пн Апр 15 13:24:21 2013 сказал:

    небольшие комментарии по поводу предлагаемых вами грунтовок:

    третий триплет из добавленных оснований обратного праймера: вы написали «таа», я думаю, вы имели в виду «тта»

    Если вы заканчиваете оба праймера буквой «т», рекомендуется заканчивать буквой «г» или «с», чтобы закрепить праймер.

    Спасибо, я этого не заметил.

    Об окончании праймеров буквой «G» или «C». праймеры, которые я сделал, в основном просто дополнения моих шаблонов, чтобы они заканчивались буквой «G» или «C», есть ли идея просто сократить мой праймер до тех пор, пока я не получу конец «C»? т.е. для прямого праймера:

    ИЗ:
    5 & ​​# 39 (GCATGC GGATCC ATG) TTG TAT AAA GGA TGC TGC CAT GTT 3 & # 39

    К:
    5 & ​​# 39 (GCATGC GGATCC ATG) TTG TAT AAA GGA TGC TGC 3 & # 39

    Рекомендуемая длина праймера 18-30 пар оснований должна включать все эти основания, верно? Таким образом, ваша (фактическая последовательность праймера + дополнительные связывающие основания + сайт рестрикции и стартовый и стоп-кодоны) должны в сумме составлять максимум 30?

    Если ваша последовательность начинается в ATG, тогда нет необходимости добавлять стартовый кодон, верно?

    Как бы вы использовали инструмент для создания праймеров таким образом, чтобы он помещал ваши праймеры там, где они вам нужны?, как и в моем случае, мне нужны праймеры в начале моей кодирующей последовательности для белка CobT, поскольку я хочу иметь возможность экспрессировать CobT.

    Хорошо, я просто использовал эту информацию, чтобы сделать учебники для моего настоящего проекта.
    Правильная грунтовка - это нормально.
    Левый вызывает у меня проблемы с содержанием GC, его 68-70%. Есть ли способ снизить это значение, кроме попытки изменить используемые праймеры? Моя конечная последовательность в значительной степени заполнена основаниями G и C. Это последние 36 пар оснований моей белковой последовательности:
    CAG GCC GGT GTG TCC GAC CCG TCC GCT CAC CCG TGA

    taiju в Пн Апр 15 14:52:43 2013 сказал:

    Об окончании праймеров буквой «G» или «C». праймеры, которые я сделал, в основном просто дополнения моих шаблонов, чтобы они заканчивались буквой «G» или «C», есть ли идея просто сократить мой праймер до тех пор, пока я не получу конец «C»? т.е. для прямого праймера:

    ИЗ:
    5 & ​​# 39 (GCATGC GGATCC ATG) TTG TAT AAA GGA TGC TGC CAT GTT 3 & # 39

    К:
    5 & ​​# 39 (GCATGC GGATCC ATG) TTG TAT AAA GGA TGC TGC 3 & # 39

    Рекомендуемая длина праймера 18-30 пар оснований должна включать все эти основания, верно? Таким образом, ваша (фактическая последовательность праймера + дополнительные связывающие основания + сайт рестрикции и стартовый и стоп-кодоны) должны в сумме составлять максимум 30?

    вы можете как увеличивать, так и уменьшать. кроме того, вам не нужно вносить изменения с триадами, вы можете менять по одной базе за раз, чтобы вы могли просто удалить «tt», чтобы перейти к «g», или вы могли бы добавить «c» (или « cc ") до конца, чтобы установить зажим.

    помните, что вы продолжаете с конца праймера, поэтому вам не нужно вносить изменения в три для сохранения кодирующей последовательности.

    необходимая длина праймера учитывает только фактическую последовательность праймера. остальное не отжигает.

    mdfenko on Пн Апр 15 16:27:16 2013 сказал:

    taiju в Пн Апр 15 14:52:43 2013 сказал:

    About ending the primers with a "G" or "C". the primers I made are basically just complements of my templates, to make them end with "G" or "C" is the idea to just shorten my primer until I get a "C" end? i.e for the forward primer:

    FROM:
    5' ( GCATGC GGATCC ATG) TTG TAT AAA GGA TGC TGC CAT GTT 3'

    TO:
    5' ( GCATGC GGATCC ATG) TTG TAT AAA GGA TGC TGC 3'

    The recommended primer length of 18-30bp should include all these other bases right? So your (actual primer sequence+additional binding bases+restriction site and start and stop codons) should all add up to a maximum of 30?

    you can increase as well as decrease. also, you don't have to make the change with triads, you can change one base at a time so you could just remove the "tt" to get to the "g" or you could have added a "c" (or "cc") to the end to set up the clamp.

    remember, you are extending from the end of the primer so you don't have to make changes in threes to maintain the coding sequence.

    the necessary primer length takes into consideration only the actual primer sequence. the rest doesn't anneal.

    You just answered a question I was about to ask, thank you as I was wondering about what happens to the rest of the bases you add but if they don't anneal how do you get an amplicon that has the restriction site and the start/stop codons, like if only the actual primer sequence anneals and is replicated and the additional bases are just kind of hanging how do they get into the subsequently produced PCR products.. I hope my question makes sense.

    The primer ends get copied by the subsequent cycles of PCR, its just the initial cycles where there are "free" ends.


    Смотреть видео: Грунтовка и клей ПВА, одно и тоже? Вся правда о грунтах глубокого проникновения. (August 2022).